Digital Biology Friday: A microbiology blast puzzler

<< Return to the Archive

Share to: 
Sandra Porter
Here's a fun puzzler for you to figure out. The blast graph is here:
i-02f5f2aaa95bc8ab8660ebaba090a49e-graph.png
The table with scores is here, click the table to see a bigger image: i-c6f0f4e4fc0d3b6f0f299d302de71acd-smaller_table.png And here is the puzzling part: Why is the total score so high? If you want to repeat this for yourself, go here. You can use this sequence as a query (it's the same one that I used). >301.ab1 CTAGCTCTTGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCCGATGGAG GGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGTGGGGGA CCTTCGGGCCTCACACCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGG CTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGA CACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTG ATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGAGGAGG AAGGCATTGTGGTTAATAACCGCAGTGATTGACGTTACTCGCAGAAGAAGCACCGGCTAAC TCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAA AGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCA TTCGAAACTGGCAGGCTAGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAAT GCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACGAAGACTGACGCTC AGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGAT GTCTATTTGAAGGTTGTTCCCTTGAGGAGTGGCTTTCGGAGCTAACGCGTTAAATAGACCGCC TGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTG GAGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACTCTTGACATCCAC And change the database to Reference genomic sequences. I'll post the answer next Friday.

Privacy     |     Using Molecule World Images    |    Contact

2017 Digital World Biology®  ©Digital World Biology LLC. All rights reserved.