BLASTing through the kingdom of life: Sequences

The GenBank database at the NCBI (National Center for Biotechnology Information) contains millions of nucleotide and protein sequences. The BLAST family of programs at the NCBI can be used to compare unknown sequences to all the sequences in GenBank and find sequences that match. This can be helpful for determining the possible identity of an unknown sequence and for identifying related sequences from other organisms.

In this activity you will use BLAST to identify unknown sequences and look for related sequences in other organisms.

1. Open the BLAST tutorial in a separate web browser window. We recommend that you adjust the window size in order to view the tutorial in one browser window and use BLAST in the other window. 

2. Open the NCBI BLAST home page site in a third window. This is where you'll do the blast search.

3. Copy your sequence from the sequence data set (after reading the instructions), identify it using BLAST, and answer the questions on the BLAST worksheet. The worksheet includes example answers.

Copy the DNA sequence using one of three ways.

  • Use your mouse to highlight your sequence.
  • Click the right mouse button and select Copy.
  • Open the Edit menu in web browser and select Copy.
  • Use the keyboard commands (Ctrl + C for Windows, Command + C for Mac).

**Be sure to copy the entire sequence including the > symbol and the name.

Paste your sequence in the BLAST text box, using one of three methods:

  • Click the right mouse button and select Paste.
  • Open the Edit menu in web browser and select Paste.
  • Use the keyboard commands (Ctrl + V for Windows, Command + V for Mac).

You should be aware that the NCBI web changes regularly. Although the information in the tutorial is current, the NCBI web page may appear slightly different.

4. To get your sequence, either click the link below, or scroll down the page. There are 16 sequences in this data set and one example sequence.


List of sequences
1  2   3     5   6   7   8    9   10    11   12   13   14   15   16

>Example

CGAGGGACCTTTACGGCGTAATCCTGGAAACCATGACAAATCCAGAACCCCAAGGCTCCCCTCTT
CAGCTGATGTAGAATTTTGCCTGAGTTTGACCCATGGAAGGATTTGCTAGTCCACTTACTGGGAT
AGCGGATGCCTCTCAAAGAGCATGCACAATGCCTTGCACATCTATATGAATGGAACAATGTCCCA
GGCAGGGATCTGCCAACGATCCTATCTTCCTTCTTCACCATGCATTTGTTGACAGTATTTTTGAG
CAGTGGCTCCGAAGGCACCGTCCTCTTCAAGAAGTTTATCCAGAAGCCAATGCACCCATTGGACA
TAACCGGGAATCCTACATGGTTCTTATACCACTGTACAGAAATGGTGATTTCTTTATTTCATCCA
AAGATCTGGGCTATGACTATAGCTATCTACAAGATTCAGACCCAGACTCTTTTCAAGACTACATT
AAGTCCTATTTGGAACAAGCGAGTCGGATCTGGTCATGGCTCCTTGGGGCGGCGATGGTAGGGGC
CGTCCTCACTGCCCTGCTGGCGGGCTTGTGAGCTTGCTGTGTCGTCACAAGAGAAAGCAGCTTCC
TGAAGAAAAGCAGCCACTCCTCATGGAGAAAGAGGATTACCACAGCTTGTATCAGAGCCATTTAT
AAAAGGCTTAGGCAATAGAGTAGGGCCAAAAAGCCTGACCTCACTCTAACTCAAAGTAATGTCCA
GGTTCCCAGAGAATATCTGCTGGTATTTTTCTGTAAAGACCATTTGCAAAATTGTAACCTAATAC
AAAGTGTAGCCTTCTTCCAACTCAGGTAGAACACACCTGTCTTTGTCTTGCTGTTTTCACTCAGC
CCTTTTAACATTTTCCCCTAAGCCCATATGTCTAAGGAAAGGATGCTATTTGGTAATGAGGAACT
GTTATTTGTATGTGAATTAAAGTGCTCTTATTTTAAAAAATTGAAATAATTTTGATTTTTGCCTT
CTGATTATTTAAAGATCTATATATGTTTTATTGGCCCCTTCTTTATTTTAATAAAACAGTGAGAA
ATCT

 

>Sequence 1

TCGAAATAACGCGTGTTCTCAACGCGGTCGCGCAGATGCCTTTGCTCATCAGATGCGACCGCAAC
CACGTCCGCCGCCTTGTTCGCCGTCCCCGTGCCTCAACCACCACCACGGTGTCGTCTTCCCCGAA
CGCGTCCCGGTCAGCCAGCCTCCACGCGCCGCGCGCGCGGAGTGCCCATTCGGGCCGCAGCTGCG
ACGGTGCCGCTCAGATTCTGTGTGGCAGGCGCGTGTTGGAGTCTAAA

 

>Sequence 2

GTTTATTAGTGATCATGGCTAAGTTTGCGTCCATCATCGCACTTCTTTTTGCTGCTCTTGTTCTTT
TTGCTGCTTTCGAAGCACCAACAATGGTGGAAGCACAGAAGTTGTGCGAAAGGCCAAGTGGGACAT
GGTCAGGAGTCTGTGGAAACAATAACGCATGCAAGAATCAGTGCATTAACCTTGAGAAAGCACGAC
ATGGATCTTGCAACTATGTCTTCCCAGCTCACAAGTGTATCTGCTACTTTCCTTGTTAATTTATCG
CAAACTCTTTGGTGAATAGTTTTTATGTAATTTACACAAAATAAGTCAGTGTCACTATCCATGAGT
GATTTTAAGACATGTACCAGATATGTTATGTTGGTTCGGTTATACAAATAAAGTTTTATTCACCA

 

>Sequence 3

CTCGAGACTAGTTCTCTCTCTCTCTCTCTCGTGCCGCATCTCACACCTGTGGATGGACGGCAGCTG
AACCGCGGGAAACTTTCGTTCTCACTCTACCTAGATGAACTTTAGTTTATATTAAACACGCGTCGA
CTCCCACACAAACCGTGCTCGTTTTACATCTTTGTCTCCGCTTTTGAAAACGAGAAGTTGAATTCG
CAAGACGCAACTTTCCAGCCCCTCACTGAGCGGGCAGAGTCCGTGAAGCGATGGAGCCGTCCGTCA
TTCCCGGTGCTGACATACCCGACCTTTACTCCATTAACCCGTTTAATGTCACTTTTCCCGACGACG
TTTTGAGTTTCGTTCCTGATGGGAGGAACTACACCGAACCTAACCCGGTAAAGAGCCGCGGAATCA
TCATCGCCATTTCCATCACCGCTC

 

>Sequence 4

GACATTACGGCGACCCAGTCTCCCCCGGTGTTGTCAGTGGGACTGGGCCAGACCGCAACCATCACTT
GTACGGCCAGTCAAAGCATCTACAGTAACCTTGCTTGGTACCAGCAGAGAGAAGGACAGAAGCCCTC
TCTCCTGATCTATGCTGCGACAACGCGATACGAAGGAGTCTCCGAGCGATTCAGCGGCAGTGGATCA
GGGACCAGTTTCACCCTGACAATCAGCAACGTTCAGAATGAGGATGTCGCTGACTATTACTGTCAGA
TCGCATATTCGATCTACTCCGGTTCCGTTGTTTTCGGTGAAGGAACCAAGCTCAGACTGAGCCGT

 

>Sequence 5

GAATTCGCGGCCGCATGGGGGAGAAGCTGCCGGTTGTGTATAAACGCTTCATCTGCTCGTTCCCGGA
TTGTAATGCCACGTATAACAAGAACCGGAAGCTGCAGGCCCATCTGTGCAAGCACACGGGGGAGAGA
CCGTTTCCTTGCACATATGAAGGCTGTGAGAAAGGCTTTGTGACGCTGCATCACCTGAATCGTCATG
TGCTCTCCCACACCGGGGAGAAACCCTGCAAATGCGAAACGGAAAATTGCAATTTGGCGTTCACCAC
AGCATCCAACATGAGGTTGCACTTCAAAAGGGCTCATTCTTCTCCGGCGCAGGTCTACGTGTGTTAT
TTCGCAGACTGTGGCCAGCAGTTCAGGAAACATAACCAGCTAAAAATTCACCAGTATATCCATACAA
ACCAGCAACCCTTCAAAT

 

>Sequence 6

GCCCAGCGTCTCTCGGAGGAAGCTAATTCTCAGGTTATCGCAGAGGAATCTCTTGTAGCTCGTGCTGA
GGCTACCGTTGTCCAAGCCGCCGCTCCAACCAAATCCCTTGATCTGACAACATGGAAGTATGCTGATC
TCAGAGACACTATCAACACCTCAATCGATATTGCGCTCCTGTCAGCCTGCAAGGAGGAGTTCCATCGT
CGTCTCAAGGTCTACCACGCCTGGAAGATGAAGAATAAGAAGGTTGCCGCCGGCGACAAGGGCGGACC
AGAGAGGGCTCCACAATCCATCTTTGAAAGTGCCCAACAATACAACCAGCTGGCACCCCCTCCGAAAG
CCACCAAGGCTGCCCCAGCCAATCAGAACATCCAACGCTTCTTCAGGGTGCCTTTCTCCGTGACTGGG
TCCACCGCTCAGGGTCAGATGCCCGAGAGGGGTTGGTGGTACGCCCACTTTGACGGTCAGTGGATCGC
CCGCCAGATGGAGGTACACCCCACCAAGGTCCCCGTTCTTCTGGTTGCAGGTAAAGATGATGAGAACA
TGTGTGAGATGAGTTTGGAGGAGACTGGGTTGACACGACGTCCCAACGCCGAGATCGTCGAGCGGGAG
TTTGAGGAGCCCTGGAAGCGTAGCGGCGGTCAGCAGTACCACATGGCTGCAGTACGCAACAAGCAGGC
TAGACCAACGTGGGCCACGCAGAGCTTGAA

 

>Sequence 7

AACAATTCATTTTTCCTGCTTTCCTAGAAAATTCTATAAAAGCTTCAAAATGAATTACTTGGTGATGA
TTAGTTTGGCACTTCTCTTCGTGACAGGTGTAGAGAGTGTAAAAGACGGTTATATTGTCGACGATGTA
AACTGCACATACTTTTGTGGTAGAAATGCATACTGCAACGAGGAATGTACCAAGTTGAAAGGTGAGAG
TGGTTATTGCCAATGGGCAAGTCCATATGGAAACGCCTGTTATTGCTATAAATTGCCCGATCATGTAC
GTACTAAAGGACCAGGAAGATGCCATGGCCGATAAATTATAAGATGGAATGTATCCTAAGTATCAATG
TTAAATAAATATAATCAAAAAATT

 

>Sequence 8

ACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAAC
TGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCTGATCAAGAGACAGGATGA
GGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTA
TTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAG
GGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCG
CGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGA
AGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCC

 

>Sequence 9

AACCAACCCAACTCGCCGCCGCATCGCCCTCGTTAGAACGATGGCCGCGTCGGCGCTGCACCAGACCAC
CAGCTTCCTCGGCACCGCCCCTCGCCGGGATGAGCTCGTCCGCCGCGTCGGCGACTCCGGTGGCCGCAT
CACCATGCGCCGCACCGTCAAGAGCGCGCCCCAGAGCATCTGGTATGGACCTGACCGTCCCAAGTACCT
GGGCCCGTTCTCGGAGCAGACGCCATCGTACCTGACCGGAGAGTTCCCGGGAGACTACGGGTGGGACAC
GGCGGGGCTATCGGCCGACCCGGAGACGTTCGCGAGGAACAGGGAGCTGGAGGTGATCCACTCGCGGTG
GGCGATGCTGGGGGCGCTGGGCTGCGTCTTCCCGGAGATCCTGTCCAAGAACGGGGTGAAGTTCGGGGA
GGCGGTGTGGTTCAAGGCCGGCGCGCAGATCTTCTCCGAGGGGGGGCTCGACTACCTGGGGAACCCCAA
CCTGGTGCACGCGCAGAGCATCCTCGCCATCTGGGCGGTCCAGGTGGTGCTCATGGGATTCGTCGAGGG
CTACCGCGTCGGCGGCGGCCCGCTCGGCGAGGGCCTCGACAAGGTGTACCCAAGCGGCGCCTTCGACCC
GCTCGGCCTCGCCGACGACCCTGACACCTTCGCCGAGCTCAAGGTGAAGGAGCTCAAGAACGGCCGCCT
CGCCATGTTCTCCATGTTCGGCTTCTTCGTCCAGGCCATCGTCACCGGCAAGGGCCCCATCGAGAACCT
CTTCGACCACGTCGCCGACCCCGTCGCCAACAACGCCTGGGCATACGCCACCAACTTCGTCCCCGGCAA
GTGAGCACAACGACACGATCGAGATGGTGCCAACCAACGTACCATGTGTACACTTGTAGTAGCCACGCA
CCGACCCTGCAGTTGCAGTTGCAGCAGTGCATGTATGTATGTACCTTAATTGTGTGTGTGTGTGTGATC
GATCGAGGAGATTTCTAGCTTAATTAATTTCTGTC

 

>Sequence 10

ACTCAACGTAAATCAGAAGATTCCAACTGCAGTGGAAGGCAGCACATGAAATAAATTACTTGTTAGAAAG
AATACTGCCAACAGCATAGCAAAATGAAATTCTTCCTGCTGCTTTCCCTCATTGGATTCTGCTGGGCCCA
ATATGACCCACATACTCAATATGGACGAACTGCTATTATCCACCTGTTTGAGTGGCGCTGGGTTGATATT
GCTAAGGAATGTGAGAGATACTTAGCTCCTAATGGATTTGCAGGTGTGCAGGTCTCTCCACCCAATGAAA
ACATCGTAGTCCACAGCCCTTCAAGACCATGGTGGGAAAGATATCAACCAATTAGCTACAAAATATGTTC
CAGGTCTGGAAATGAAGATGAATTCAGGGACATGGTGAACAGGTGCAACAATGTTGGTGTCCGTATTTAT
GTGGATGCTGTCATTAACCACATGTGTGGAGTGGGGGCTCAAGCTGGACAAAGCAGTACATGTGGAAGTT
ATTTCAACCCAAATAACAGGGACTTTCCTGGAGTTCCCTATTCTGGTTTTGACTTTAATGATGGAAAATG
TAGAACTGCAAGTGGAGGTATCGAGAACTACCAAGATGCTGCTCAGGTCAGAGATTGTCGTCTGTCTGGC
CTTCTGGATCTTGCACTTGAGAAAGATTATGTTCGAACCAAGGTGGCTGACTATATGAACCATCTCATTG
ACATTGGCGTAGCAGGGTTCAGACTTGATGCTTCTAAGCACATGTGGCCTGGAGACATAAAGGCAATTTT
GGACAAACTGCATAATCTCAATACAAAATGGTTCTCCCAAGGAAGCAGACCTTTCATTTTCCAAGAGGTG
ATTGATCTGGGTGGTGAGGCAGTGTCAAGTAATGAGTATTTTGGAAATGGCCGTGTGACAGAATTCAAAT
ATGGAGCAAAATTGGGCAAAGTTATGCGCAAGTGGGATGGAGAAAAGATGTCCTACTTAAAGAACTGGGG
AGAAGGTTGGGGTTTGATGCCTTCTGACAGAGCCCTTGTGTTTGTGGACAACCATGACAATCAGCGAGGA
CATGGTGCTGGGGGAGCATCCATCTTGACATTCTGGGATGCTAGACTCTATAAAATGGCTGTTGGCTTTA
TGTTGGCTCATCCTTATGGTTTCACACGGGTGATGTCAAGTTACTATTGGCCAAGAAATTTCCAGAATGG
AAAAGATGTCAATGACTGGGTTGGACCACCAAATAACAATGGAAAAACCAAAGAAGTGAGCATTAACCCA
GACAGCACTTGTGGCAATGACTGGATCTGTGAACATCGATGGCGTCAAATAAGGAACATGGTTGCCTTCA
GAAATGTCGTCAATGGTCAGCCTTTTGCAAACTGGTGGGATAATGACAGCAACCAGGTAGCTTTTGGCAG
AGGAAACAAAGGACTCATTGTCTTTAACAATGATGACTGGGCTTTGTCAGAAACTTTACAGACTGGTCTT
CCTGCTGGCACATACTGTGATGTCATTTCTGGAGATAAAGTCGATGGCAATTGCACTGGAATAAAAGTCT
ATGTTGGCAATGATGGCAAAGCTCACTTTTCTATTAGTAACTCTGCCGAAGACCCATTTATTGCAATCCA
TGCAGAGTCAAAAATATAAAATTTAAAATAAACACATATTGAGAGCATCA

 

>Sequence 11

TGCATCACAAGGTTAATGTGAAAACACAGCGAGAAGTCCATTTCCCAATGGACCTCTTGCAAGCCTGTGGT
GCATCTGCCCCTAGGCCAGTTGCCCGTGTTTCACGTGCAACCGACCTAGACCGACGCTACAGGTGCGTCCT
CAGTTTACCTGAGGAGCGTGCTCGCAGTGTTGGGTGTAAATGGTCGTCGACCCGAGCGGCGTTACGACGTG
GACTCGAGGAGCTTGGCTCCCGCGAGTTCCGCCGTCGTCTCCGTTTGGCGGACGATTGCTGGCGCGCGATC
TGCGCGGCCGTCTGCACGGGTCGGAAGTTTCCTTCCTTCTCGGTGACAGATCGGCCGGCAAGAGCTCGCCT
TGCAAAAGTCTACCGTATGGGTCGTCGACTGCTAGTAGGTGTGGTCTGCCGAGGCGAATCGGTCG

 

>Sequence 12

ATAACCACACGCCTTTGGCGTGATTATCAGCTTTCAAGTTTCAGTTACTAAAACTAATACTGACTATAAAA
CAGAAGCAAAAAAATTTTCGATTTTTATGAAAACGGTCGCAAAGAAGTTAGCAAAAATATATAATTTCTTT
TGAAATTGTTCACTTGGCCAAGCTGCAGTTTCAATATTTTAATAAAGGGGGCAGTAAAAAGTGAAAAAAAA
GAAAAGTTTCTGGCTTGTTTCTTTTTTAGTTATAGTAGCTAGTGTTTTCTTTATATCTTTTGGATTTAGCA
ATCATTCTAAACAAGTTGCTCAAGCGGCTAGTGATACGACATCAACTGATCACTCAAGCAATGATACAGCT
GATTCTGTTAGCGACGGTGTTATTTTGCATGCATGGTGCTGGTCGTTCAACACGATTAAAAACAACTTGAA
ACAGATTCATGACGCCGGCTACACAGCGGTTCAAACTTCACCTGTTAATGAAGTTAAAGTTGGAAATAGCG
GGTCTAAGTCATTAAATAACTGGTATTGGCTATATCAGCCAAC

 

>Sequence 13

GTGCGCGTTAGACCATATAAAGAAAAACCAATACAAACTCCAGCAAAATCTGTTGATATAAGATATACTGTA
CAGTTTACTCCTTTAAACCCTGATGATGATTTCAAGCCAGTTCTCAAAGATACTAAACTATTGAAAACATTA
GCTATCGGCGACACCATCACATCCCAAGAATTACTAGCTCAAGCACAAAGCATTTTAATCGAAAGCCATCCA
GATTATACGATTTATGAACGTGATTCCTCAATCGTCACTCATGACAATGACATTTTCCGTACGATTTTACCA
ACGGATCAAGAGTTTACTTACCATGTCAAAAATCGGGAACAAGCTTATAAGGCCAATTCTAAAACAGATATT
AAAGAAAAAACGAACAACACCGAC

 

>Sequence 14

CTAATAATCCTTGGAATACTCCTATATTTTGTATAAAGAAGAAATCAGGGAAATGGAGAATGCTAATTGATT
TTAGAGAACTTAATGCAAAAACAGAAAAAGGAGCAGAAGTCCAATTAGGATTACCTCACCCATCTGGATTAC
AGAAGAGAAAGAATGTAACAGTTTTAGATATAGGAGATGCTTATTTTACCATCCCTTTAGATCCTGATTATC
AGCCCTATACTGCATTTACTTTACCATCTAAGAATAATCAAAGTCCAGGAAAAAGGTATATTTGGAAATCTC
TTCCACAGGGGTGGGTCTTGAGTCCCTTAATATACCAGAGCACTCTAGATAATATTCTACAACCATTTAGAA

 

>Sequence 15

ATGTTTTCCGGTGGCGGCGGCCCGCTGTCCCCCGGAGGAAAGTCGGCGGCCAGGGCGGCGTCCGGGTTTTTT
GCGCCCGCCGGCCCTCGCGGAGCCGGCCGGGGACCCCCGCCTTGCTTGAGGCAAAACTTTTACAACCCCTAC
CTCGCCCCAGTCGGGACGCAACAGAAGCCGACCGGGCCAACCCAGCGCCATACGTACTATAGCGAATGCGAT
GAATTTCGATTCATCGCCCCGCGGGTGCTGGACGAGGATGCCCCCCCGGAGAAGCGCGCCGGGGTGCACGAC
GGTCACCTCAAGCGCGCCCCCAAGGTGTACTGCGGGGGGGACGAGCGCGACGTCCTCCGCGTCGGGTCGGGC
GGCTTCTGGCCGCGGCGCTCGCGCCTGTGGGGCGGCGTGGACCACGCCCCGGCGGGGTTCAACCCCACCGTC
ACCGTCTTTCACGTGTACGACATCCTGGAGAACGTGGAGCACGCGTAC

 

>Sequence 16

CTCGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGGATCTGCCCGATAGAGGGGGATAACCACTGGAA
ACGGTGGCTAATACCGTATAACGTCGCRAGACCAAAGAGGGGGACCTTCGGGCCTCTCACTATCGGATGAAC
CCAKATGGGATTAGCTAGTRSGCGGGGTMACGGGCCCACCTAGGCGACKATCCCTAGCTGGTCTGAGAGGAT
GACCAGCCACACTGGAACTGASACACGGYCCASACTCCTACGGGRGGCAGCAGKGGGGAATATTGCACARTG
GGCGCAMGCCTGATGCASCCATGCCGYGTGTATGAAGARGGCCTTCGGGTTGTAAAGTWCTTTCAGCGGGGA
GGAAGGCKATGTGGTTAATAACCGCVTYGATTGACGTTACCCGCAGAAGAAGCACCGKCTAACTCCGTGCCA
GCAGCCGCGGTWATACGGAGGG

 


Copyright © Digital World Biology All rights reserved.

Privacy     |     Using Molecule World Images    |    Contact

2017 Digital World Biology®  ©Digital World Biology LLC. All rights reserved.